Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-CLONE-1591297

Clone Name: IMAGE:8538777 Gene: gdpd1.L Species: Xenopus laevis  
 

Sequence:

5' EST: EB466919 [+]

Library:

Name: NICHD_XGC_olfbExternal Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.25 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: brainStage: unspecified stage
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pCS111

Type: plasmid

5' Restriction Site: SmaI

3' Restriction Site: NotI
Expression Image

Usage:


Suppliers:

Search for clone at: Open Biosystems