Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Genes Attributions
XB-LIB-135

Library Name: RT-PCR product from stage 20 RNA

Species: Xenopus laevis

Number Of Clones: 1


Description: RT-PCR product was generated from Xenopus stage 20 RNA using the primers:-5' AGAGCCCAGAATGAAAATGC; 3' TGAAAGGAGAAAGCCATAGG

Normalized: No Subtraction: No
Anatomy: whole organism Stage: NF stage 20