|
XB-LIB-162
Library Name: NICHD_XGC_int_m |
Species: Xenopus laevis |
Number Of Clones: 8013 |
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
Normalized: No | Subtraction: No |
Anatomy: whole organism | Stage: NF stage 56 to NF stage 62 |
Vector Details | Vector Map | Name: pCS111 Type: plasmid 5' Restriction Site: SmaI 3' Restriction Site: NotI |