Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Genes Attributions
XB-LIB-60

Library Name: NICHD_XGC_tropInt_60

Species: Xenopus tropicalis

Number Of Clones: 3217


Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Normalized: No Subtraction: No
Anatomy: intestine Stage: frog

Vector DetailsVector Map
Name: pCS111

Type: plasmid

5' Restriction Site: SmaI

3' Restriction Site: NotI		Expression Image