|
Fig. 1. vpp1 and hhex display partially overlapping expression in gas- trulating dorsal endoderm and later demarcate ventral pancreatic buds and liver anlagen, respectively. (A) Comparison of vpp1 and hhex expression as revealed by whole mount in situ hybridization analysis with bisected (stages 118) or whole (stages 243) embryos. (1, 2, 5, 6, 9, 10, 13, and 14) Dorsal is toward the right; (172) lateral view, head toward the left. Images 3, 7, 11, and 15 are cartoons drawn representing both the single staining (images 1, 2, 5, 6, 9, 10, 13, and 14) and double staining whole mount in situ hybrid- ization data (Fig. S3B), illustrating vpp1 (purple) and hhex (turquoise) ex- pression. Boxed regions are magnified in 4, 8, 12, and 16, respectively. (B) RT-PCR analysis compares the temporal expression profile of vpp1 and hhex during Xenopus embryogenesis. Ornithine decarboxylase (odc) was used as the RNA loading control.
|
|
Fig. 2 The expression of vpp1 is regulated by hhex. Overexpression of hhex- induced ectopic expression of vpp1 (A, D, G, and J), and hhex knockdown led to the down-regulation of vpp1 expression (C, F, I, and L) compared with controls (B, E, H, and K). (A) Bisected embryos: A, dorsal toward the right; D, anterior toward the left; G, anterior toward the top; each image displays twin halves dissected from the same embryo. (J) Lateral view, head toward the left. Phenotype shown are as follows: A, 34/34; C, 47/48; D, 28/32; F, 30/30; G, 25/30; I, 20/20; J, 15/15; L, 28/28; M, 26/28; O, 31/31.
|
|
Fig. 3. Ectopic hhex converts intestine-forming cells into vpp1-expressing cells. Whole mount staining was performed with probes indicated on the left. (A) Bisected embryos, anterior toward the left. Phenotype is as fol- lows: B, 28/32; E, 34/40; H, 21/21; K, 42/42. (L) Statistic analysis of phospho- histone H3-positive cells on the whole surface of bisected vegetal endoderm, as demarcated by the red dashed lines in J and K. As the distribution of phospho-histone H3-positive cells across the whole vegetal endoderm sur- face did not show obvious bias, for simplicity, we counted the whole area rather than only putative vpp1-positive area. Forty-two bisected samples were counted from either control or hhex-injected embryos. P value (0.156) was determined by the paired, two-tailed t test.
|
|
Fig. 4. Ectopic hhex-induced ventral pancreatic progenitors undergo normal endocrine and exocrine differentiation. Whole mount staining was performed with molecular probes indicated on the left. (A) Lateral view, head toward the left. Phenotype is as follows: B, 18/20; D, 40/40; F, 21/21; H, 31/31; J, 19/19; L, 32/32. (M and N) Right side views of the same embryos in K and L, respectively, showing that in the control embryo, because of the unilateral location of pancreas, stomach, and duodenum on the left side of the embryo at this developmental stage, fibrinogen stains a continuous area between the intestine and the liver bud. In contrast, in hhex-injected embryos, the anterior, fibrinogen-positive area is interrupted by the ectopically formed ventral pancreatic cells. (O and P) Ventral view, head toward the top. Phenotype is as follows: P, 51/51. (Q and R) Pancreata isolated from elastase: GFP transgenic Xenopus tadpoles (stage 47) with or without hhex over-expression. They were kept in the same Petri dish and photographed together in the same visual field and magnification. The dashed white line was added for a better alignment. Phenotype is as follows: R, 32/32. (S) Whole mount in situ hybridization of insulin on isolated liver and annular pancreata. Red asterisks highlight liver lobes. U shows the other side of the same liver and pancreata in T. The darker structure above the red asterisk in U is the deformed gall bladder. Note that there are two liver lobes in control embryos, but only one liver lobe in hhex-injected embryos (100%, n = 11).
|
|
Fig. 5. Liver and ventral pancreas defects in hhex morphants. Probes or methods for whole mount staining are indicated on the left. (A and B) Bisected embryos, dorsal toward top. (C) Lateral view, head toward the left. (I and J) Bisected embryos, anterior toward the left. (K) Lateral view, head toward the left. The white arrowhead (N) indicates the missing expression of fibrinogen in the liver anlage. (S) Bisected embryos, anterior toward the left. Phenotype is as follows: B, 19/20; D, 20/22; F, 24/25; H, 34/41; J, 25/27; L, 38/44; N, 19/20; P, 36/42; R, 16/72 (for detailed phenotype analysis, see Fig. S7); T, 22/23; V, 41/41. (W) Statistical analysis of phospho-histone H3-positive cells in the outlined areas in U and V. Thirty-four samples from 17 bisected embryos were counted from either control MO or hhex MO-injected embryos. P value (0.309) was determined by the paired, two-tailed t test.
|
|
Fig. S1. The shorter version of vpp1 transcripts is dominantly expressed during early embryonic development. (A) Schematic drawing showing two versions of exon/intron distribution caused by alternative splicing, which was drawn according to the information from the National Center for Biotechnology Information database for Xenopus tropicalis homologs of vpp1 gene. (B) Comparison of primary amino acid sequences of two vpp1 splicing variants. (C) RT-PCR analysis of developmental expression of the two vpp1 isoforms (GenBank accession nos.: JF439311, JF439312). The vpp1 primers used here are as follows: forward 5′CCAGACTTACTGAGGGTTCTG3′ and reverse 5′GGAGGAGGAGACAAAGGATTA3′. Odc was used as the loading control.
|
|
Fig. S2. Injection of vpp1 mRNA (A, D, and G) or morpholino (C, F, and I) had no obvious effects on the expression of pancreas and liver marker genes compared with the uninjected controls (B, E, and H). vpp1 mRNA (2 ng) and vpp1 splice blocking MO (5 picomoles) were injected into four vegetal blastomeres of eight-cell stage embryos. Whole mount staining was performed with probes indicated on the left. (A) All images show lateral view, head toward the left.
|
|
Fig. S3. vpp1 is undetectable in blastulae, and a small number of cells coexpresses vpp1 and hhex at neurula and tail bud stages. (A) No vpp1 expression was detected in stage 7 and stage 9 embryos, and weak expression was detected in the subblastoporal endodermal cells at stage 10 and stage 11 by whole mount in situ hybridization. Red arrowheads in 3 and 4 point to the dorsal blastopore lips. (B and C) Embryos were subjected to double label whole mount in situ hybridization by using hhex (turquoise) and vpp1 (purple) specific probes. (B) Stage 18. (1) Ventral view, anterior toward the left. (2) Serial vibratome sections obtained from the area between the dashed lines in 1 sequentially from top to bottom. Red arrowheads in 3 point to the cells that coexpress vpp1 and hhex. The red arrowhead highlighted areas in 5 are magnified in 92, respectively. A, anterior; P, posterior. (C) Stage 24. (1) Lateral view, head toward the left. (214) Serial vibratome sections obtained from the area between the dashed lines in 1 in the order from left to right. Red arrowheads in 83 highlight the cells that coexpress vpp1 and hhex. Boxed region in 7a is magnified in 7b.
|
|
Fig. S4. Reduced vpp1 staining remaining in hhex morphants did not overlap with hhex expression. Comparison of vpp1 and hhex expression as revealed by whole mount in situ hybridization analysis with bisected embryos. For every bisected embryo, one-half was used for a vpp1 and the other half for a hhex staining. (A) Dorsal toward the right. (G and H) Head toward the left.
|
|
Fig. S5. The second wave of insulin expression occurs in hhex-induced giant pancreata in a similar way as normal pancreas differentiation in terms of expression level and scattered distribution pattern. Pancreata were isolated from stage 48 control and hhex-injected embryos and were subjected for whole mount in situ hybridization with insulin probe. Statistic analyses were carried out on serial vibratome sections from four control and four hhex-injected pancreata in Photoshop. (A and B) Representative examples of serial sections from control and hhex-injected pancreata show the size of the pancreata and the scattered distribution pattern of insulin-expressing cells. Pancreas area is demarcated by white dashed outlines. (C) Quantification. The values reflect the average level of insulin signals per square micrometer of pancreas. The total area of pancreas in hhex-injected embryos was approximately two times as large as that in control embryos. P value (0.212) in C was determined by the paired, two-tailed t test.
|
|
Fig. S6. glucagon is expressed at similar levels and distribution in control and hhex-induced giant pancreata. Pancreata were isolated from stage 48 control and hhex-injected embryos and were subjected for whole mount in situ hybridization with glucagon probe. Statistic analyses were carried out as in Fig. S5. (A and B) Representative examples of sections from control and hhex-injected pancreata show the size of the pancreata as well as the scattered distribution pattern of glucagon-expressing cells. Pancreas area is demarcated by white dashed outlines. Note that in addition to pancreatic expression, glucagon is also expressed in duodenum. (C) Quantification data. The values reflect the average ratio of glucagon signals per square micrometer of pancreas. P value (0.128) was determined by the paired, two-tailed t test
|
|
Fig. S7. Knockdown of hhex led to specific loss of Xptf1a/p48 expression in ventral pancreatic buds. (A, C, E, and G) Shown are the lateral view, head toward the left. B, D, F, and H are group photos of embryos represented in A, C, E, and G, respectively. Numbers of embryos showing phenotypes illustrated in C, E, and G are given in the individual images.
|
|
Fig. S8. vpp1 was unable to rescue the loss of ventral pancreatic expression of Xptf1a/p48 in hhex morphants. Two nanograms of vpp1 mRNA were injected either alone or together with 5 picomoles of hhex MO into four vegetal blastomeres of eight-cell stage embryos. Shown is the lateral view, head toward the left. (A) A control MO injected embryo shows normal expression of Xptf1a/p48. Numbers of embryos showing phenotypes illustrated in B are given in the individual images.
|
|
Fig. S9. Overexpression of hhex-VP16GR mimics hhex morpholino knockdown phenotype. Twenty-five picograms of hhex-VP16GR mRNA was injected into four vegetal blastomeres of eight-cell stage embryos, and dexamethasone was added at stage 9. Whole mount in situ staining probes are indicated at the top. Shown is the lateral view, head toward the left. Embryos in A, B, D, and E show normal expression of XlHbox8 and fibrinogen. White arrows in C and F highlight the loss of ventral pancreatic buds and liver anlage. Numbers of embryos showing phenotypes illustrated in C and F are given in the corresponding images.
|
|
Fig. S10. Inhibition of XlHbox8 expression by hhex-VP16GR became insignificant when dexamethasone was added after gastrulation. Twenty-five picograms of hhex-VP16GR mRNA was injected into four vegetal blastomeres of four-cell stage embryos and dexamethasone (Dex) was added at various stages of de- velopment as indicated. XlHbox8 expression was examined by whole mount in situ hybridization. (A, C, E, G, I, and K) Shown is the lateral view, head toward the left. B, D, F, H, J, and L are group photos of embryos subjected to each treatment illustrated in A, C, E, G, I, and K, respectively.
|
