Massé K , Bhamra S , Paroissin C , Maneta-Peyret L , Boué-Grabot E , Jones EA .

082071 Wellcome Trust

             Wnt signaling pathway involved in kidney development

	Fig. 1: Overexpression of enpp4 induces ectopic proximal pronephric tubules. a Schematic diagram of pronephric structural components showing the expression domain for each marker used in this study, adapted from ref. 21. G: glomus, PT: proximal tubule, IT: intermediate tubule, DT: distal tubule, CT: collecting tubule. b–y Embryos injected with 2 ng of enpp4 and 250 pg of LacZ mRNAs were examined by 3G8/4A6 antibody staining (b–o) or whole-mount in situ hybridization with the following probes: slc5a1.1 (p), slc12a1 (q), clcnkb (r) and gata3 (s) at stage 37/38; wt1 (t) and nphs1 (u) at stage 32; lhx1 (v, x) and pax8 (w, y) at stages 28 and 14. f–l Transverse sections of the embryo shown in panels (d) and (e) were cut in the anterior–posterior registers indicated by lines in panel (e). A higher magnification image (i) of ectopic pronephros in the somite indicated by square in (f) and of control kidney (k) and counterstained with Hoechst to indicate nuclei (j, l). Embryos injected with 2 ng of mouse wild-type Enpp4 (m), X. laevis mutated in the putative catalytic site (n) or in the cation binding site (o) and 250 pg of LacZ mRNAs were examined by 3G8/4A6 antibody staining. The asterisk denotes the uninjected side of each embryo. Arrowheads indicate ectopic marker staining. Blank arrowheads in (s) indicate the anterior limit of gata3 expression. See also Supplementary Table 1 for raw data and statistical analyses and Supplementary Fig. 1.
	Fig. 2: MO knock-down of enpp4 expression disrupts pronephros formation. Embryos targeted with 10 ng of enpp4 MO1 or 10 ng of both enpp4 MOs (c, n) and 250 pg of lacZ mRNA were examined by 3G8/4A6 antibody staining (a–c) or whole-mount in situ hybridization with the following probes: slc5a1.1 (d), slc12a1 (e, f), clcnkb (g) and gata3 (h) at stage 37/38; wt1 (i) and nphs1 (j) at stage 33/34, lhx1 (k–n) at stages 28, 24 and 14, pax8 (o) at stage 14. The embryo shown in (f) was co-injected with 2 ng of mouse Enpp4 mRNA to rescue enpp4 knock-down phenotype. The asterisk denotes the control, uninjected side of each embryo. Blank arrowheads in (h) indicate the anterior limit of gata3 expression. See also Supplementary Table 2 for raw data and statistical analyses and Supplementary Figs. 2 and 3.
	Fig. 3: The enpp and the lipidic receptors, the lpar and s1pr, gene family members are expressed in the pronephros. Developing pronephric anlagen or pronephric tubules were dissected as indicated, from whole X. laevis embryos and total RNA extracted. RT-PCR was performed on pronephric dissected tissues and control whole embryos along with negative and linearity controls. a Comparative expression pattern of the enpp genes and pronephric and muscle marker genes controlling the quality of the dissections. b Comparative expression profile of the lpa receptors. c Comparative expression profile of the s1pr genes.
	Fig. 4: Microinjection of enpp4 mRNA and MO affect the expression of retinoic acid synthesis enzymes, notch and wnt signalling molecules. a–g Embryos targeted with 2 ng of enpp4 and 250 pg of LacZ mRNA or h–n 10 ng of enpp4 MO1 and 250 pg of LacZ mRNA were fixed at stage 28 and examined by whole-mount in situ hybridization with the following probes: raldh1a2 (a, h), rdh10 (b, i), cyp26a1 (c, j), notch1 (d, k), dll1 (e, l), jag1 (f, m) and wnt4 (g, n). The asterisks denote the control, uninjected sides. Arrowheads indicate ectopic staining of the marker gene (see also Supplementary Table 3 and Supplementary Fig. 4).
	Fig. 5: Enpp4 is a transmembrane ectonucleotidase. a CHO cells were transfected with Xlenpp4-pcDNA3.1 or empty vector (control) and the cellular distribution of Enpp4 determined by western blotting using anti-XlEnpp4 antibody and proteins extracts from membrane (mb), soluble (sb) or whole cells (wh) fractions. b Representative images of the cellular distribution of Enpp4 determined by immunofluorescence using anti-XlEnpp4 or anti-mEnpp4 antibodies from CHO cells transfected with Xlenpp4-pcDNA3.1, Xlenpp4T72S-pcDNA3.1, mEnpp4-pcDNA3.1 or empty pcDNA3.1 vector (control). Corresponding brightfield images are also presented. Scale bar represents 20 µm.
	Fig. 6: Enpp4 pronephric functions are mediated by the S1pr5 receptor. Injected embryos were examined by 3G8/4A6 antibody staining following a, b double targeted injection of 2 ng s1pr5.l mRNA and 1 ng of enpp4 mRNA, c single targeted injection of s1pr5.l, d enpp4 mRNA or e, f embryos injected with 15 ng of s1pr5.L MO. g, h Double targeted injection of 7.5 ng of s1pr5.L MO and 5 ng of enpp4 MO1. i, j Single targeted injection of s1pr5.L MO (i) or enpp4 MO1 (j). k, l Double targeted injection of 15 ng of s1pr5.L MO and 2 ng of enpp4 mRNA (k) and 15 ng of cMO and 2 ng of enpp4 mRNA (l). An asterisk denotes the control uninjected side. An arrowhead indicates ectopic 3G8 staining (see also Supplementary Table 5 and Supplementary Figs. 6 and 7)
	Fig. 7: Enpp4 specifically binds to the lysophospholipid, phosphatidylserine. a Membrane Lipid stripTM was incubated with membrane protein extracts from Enpp4 overexpressing CHO cells and the bound Enpp4 protein detected with anti-XlEnpp4 serum. b, c Nitrocellulose membranes were spotted with increasing amount of PA or PS and incubated with membrane protein extracts from CHO cells transfected with enpp4-pcDNA3.1, with enpp4T72S-pcDNA3.1 or empty plasmid (control) and the bound proteins detected with anti-XlEnpp4 serum. LPA lysophosphatidic acid, LPC lysophosphocholine, PA phosphatidic acid, PC phospatidylcholine, PE phosphatidylethanolamine, PS phosphatidylserine, PtIns phosphatidylinositol, S1P shingosine-1-phosphate (see also Supplementary Fig. 8).
	Fig. 8: Proposed model of how Enpp4/S1pr5 controls pronephros patterning. a During normal pronephric development, in the extracellular space, Enpp4 binds to phosphatidylserine close to, or in its catalytic site, which can then either interact with the S1pr5 or produce a novel ligand X, able to bind to this receptor. The activation of S1pr5 leads to the upregulation of lhx1/pax8 pronephric markers in the kidney field either by acting upstream of RA signalling pathway or by acting directly via the ERK or calcium pathways. At later stages, RA is required for tubules morphogenesis and Notch and Wnt pathway are involved in the patterning of the pronephric tubules. The mechanism by which S1pr5 activation directs the expression domains of these genes remains to be confirmed. b Enpp4 and S1pr5 overexpression lead to expanded and ectopic expression domains for both the Notch and RA pathway genes and wnt4. These changes in patterning gene expression domains induce the formation of enlarged pronephric segments and ectopic pronephric tubules.
	Supplementary Fig. 1. Phenotypes caused by enpp4 mRNA injection (related to Fig. 1). (A) Ectopic pronephric tissues were only induced following enpp4 mRNA injection into the V2 blastomere. Embryos injected with 2ng of enpp4 and 250 pg of LacZ mRNAs into the V2, V1, D2 or D1 blastomere at 8-cell stage were examined by whole mount antibody staining 3G8/4A6 at stage 41. The black arrowhead indicates the ectopic 3G8 staining. (B- D) No change in irx1 expression and in mesoderm formation caused by enpp4 overexpression. Embryos targeted with 2ng of enpp4 and 250 pg of LacZ mRNAs were examined by whole mount in situ hybridization with the irx1 (B), myf4 (C) and xbra (D) probes at stages 14, 32 and 10.5 respectively. The asterisk denotes the uninjected side of each embryo. The black arrow in B indicates the pronephros. The white arrow in D indicates the injection site marked by the red-gal staining. The raw data and statistical analyses are provided in Supplementary Table 1.
	Supplementary Fig. 2. Enpp4 MO1 and MO2 specificity and phenotypes caused by injection of enpp4 MO2 (related to Fig. 2). (A-C) enpp4 MO1 and 2 specifically inhibited Xenopus enpp4 translation. (A) Alignment of the 5’UTR of Xenopus (Xl) and mouse (Mm) enpp4 sequences and position of enpp4 MO1 and 2 in relation to Xenopus enpp4 cDNA The ATG is indicated in bold and identical nucleotides (nt) by dots. Only 12 nt of enpp4 MO1 and 3 nt of enpp4 MO2 (located in the 5’ UTR sequence) are conserved between the two species. (B) Xenopus enpp4 but not mouse enpp4 translation was blocked by enpp4 MO1 and 2. Autoradiograph of a 10% SDS-PAGE gel of in vitro translated 35S-Methionine radiolabeled enpp4 proteins. Capped synthetic enpp4 RNA was translated in vitro in the Rabbit Reticulocyte Lysate System (Promega). Translation of Xenopus enpp4 mRNA (0.5 μg) (Lane 1) and mouse Enpp4 (Lane 2) produced a protein of 51 kDa. Xenopus enpp4, but not mouse Enpp4 (Lane 4 and 6), was almost abolished in presence of 10 μg of enpp4 MO1 or MO2 (Lane 3 and 5). (C) enpp4 MO1 is specific to enpp4 mRNA. Autoradiograph of 10% SDS-PAGE gel of in vitro translated 35S-Methionine radiolabeled Xenopus enpp2 and 6 proteins. Xenopus enpp2 and 6 RNAs were translated in vitro in the Rabbit Reticulocyte Lysate System (Promega). Translation of Xenopus enpp2 mRNA (0.5 μg) produced a protein of 99 kDa (Lane 1) that is unaffected by the addition of 10 μg enpp4 MO1 (Lane 2). Translation of Xenopus enpp6 mRNA (0.5 μg) produced a protein of 51 kDa (Lane 3) that is unaffected by the enpp4 MO1 (Lane 4). Mm: Mus musculus; Xl: Xenopus laevis. (D-E) Microinjection of enpp4 MO1 did not alter general mesoderm formation. Embryos injected with 10 ng of enpp4 MO1 at 8-cell stage were examined by whole mount in situ hybridization with the myf4 (D), myoD (D’) and xbra (E) probes at stage 32, stage 39 and at stage 10.5 respectively. Asterisk denotes uninjected sides. The arrow in (E) indicates the site of injection marked by red-gal staining. (F-N) Microinjection of enpp4 MO2 resulted in similar phenotypes than those with enpp4 MO1. Embryos injected with 10 ng of enpp4 MO2 at 8-cell stage were examined by 3G8/4A6 antibody staining at stage 40 (F and G) or whole mount in situ hybridization with the following probes: slc5a1.1 (H), slc12a1 (I and J) at stage 37/38; lhx1 at stage 28, 23 and 14 (K, L and M respectively) and pax8 at stage 14 (N). Embryo shown in (J) was co-injected with 2 ng of mouse Enpp4 mRNA for rescue experiment. Asterisk denotes uninjected sides. Arrowheads indicate ectopic slc12a1 staining. The raw data and statistical analyses are provided in Supplementary Table 2.
	Supplementary Fig. 3. Phenotypes caused by the co-injection of the enpp4 and enpp6 MOs or enpp4 MO and enpp6 mRNA (related to Fig. 2). Injection of enpp6 mRNA, but not enpp6 MO, worsened the pronephric phenotypes caused by enpp4 knock-down. Injected embryos were analysed by 3G8/4A6 antibody staining at stage 41. (A) Embryo injected with 10 ng of enpp4 MO2 and 20 ng of enpp6 MO. (B) Embryo injected with 10 ng of enpp4 MO2 and 20 ng of control MO. (C) Embryo injected with 20 ng of enpp6 MO and 10 ng of control MO. (D) Embryo injected with 2 ng of enpp6 mRNA and 10 ng of enpp4 MO. (E) Embryo injected with 2 ng of enpp6 RNA and 10 ng of control MO. Asterisk denotes uninjected sides. The raw data and statistical analyses are provided in Supplementary Table 2.
	Supplementary Fig. 4. Enpp4 expressionis regulated by activin but not by retinoic acid in animal cap assay (related to Fig. 3). Animal cap were taken at blastula stage and cultured during 3 hours in the presence of activin (A), retinoic acid (RA) or activin + retinoic acid (A+RA) and total RNA extracted. RT-PCR was performed on treated and control (C) animal caps. The amplification of odc on samples with no reverse transcriptase (-RT) was carried out to control the purity of the RNAs.
	Supplementary Fig. 5. Phenotypes caused by co-injection of enpp4 or rfng mRNA and MO (related to Fig. 4). Injection of rfng MO did not prevent ectopic pronephros formation caused by enpp4 over-expression whereas co-injection of enpp4 MO and rfng mRNA altered ectopic and endogenous pronephros formation. Injected embryos were harvested at stage 40, and analysed by 3G8/4A6 antibody staining. (A) Embryo injected with 2 ng of enpp4 mRNA and 20 ng of rfng MO. (B) Embryo injected with 2 ng of enpp4 mRNA and 20 ng of control MO. (C, D) Embryo injected with 2 ng of rfng mRNA and 10 ng of enpp4 MO2. (E) Embryo injected 2 ng of rfng mRNA and 10 ng of control MO. Asterisk denotes uninjected sides. Black arrowheads indicate 3G8 ectopic staining and white arrowheads 4A6 ectopic staining. The raw data and statistical analyses are provided in Supplementary Table 3.
	Supplementary Fig. 6. Phenotypes caused by injection of s1pr1, lpar1.1 and p2yr10 mRNA and in vitro test of the s1pr5.L MO specificity (related to Fig. 6). (A-F) Microinjection of s1pr1, lpar1.1 and p2yr10 mRNA did not induce ectopic pronephros even when co-injected with enpp4 mRNA. Injected embryos were harvested at stage 40, and analyzed by 3G8/4A6 antibody staining. (A) Embryo injected with 2 ng of s1pr1 mRNA and 1ng of enpp4 mRNA or (B) 2ng of s1pr1 mRNA alone. (C) Embryo injected with 2ng of lpar1.1 mRNA and 1ng of enpp4 mRNA or (D) 2ng of lpar1.1 mRNA alone. (E) Embryo injected with 2ng of p2yr10 mRNA and 1ng of enpp4 mRNA or (F) with 2ng of p2yr10 mRNA alone. Asterisk denotes uninjected sides. The raw data and statistical analyses are provided in Supplementary Table 5. (G-H) s1pr5.L MO specifically inhibited Xenopus s1pr5.L mRNA translation. (G) Alignment of the 5’UTR of Xenopus (Xl) and mouse (Mm) s1pr5 sequences and position of s1pr5.L MO in relation to Xenopus s1pr5.L cDNA. The ATG is indicated in bold and identical nucleotides (nt) by dots. This alignment shows that only 8 nt of s1pr5.L MO sequence are conserved between the two species. (H) Xenopus s1pr5.L but not mouse S1pr5 translation was blocked by s1pr5.L MO; autoradiograph of a 10% SDS-PAGE gel of in vitro translated 35S-Methionine radiolabeled s1pr5 proteins. Capped synthetic s1pr5 RNAs was translated in vitro in the Rabbit Reticulocyte Lysate System (Promega) according to manufacturer’s protocol. Lane 1, Translation of Xenopus s1pr5.L mRNA (1μg) produced a protein of 43 kDa. Lane 2, Translation of mouse S1pr5 mRNA (1 μg) produced a protein of 42 kDa. Lane 3, Translation of Xenopus s1pr5.L mRNA was severely affected by the addition of 10 μg of s1pr5.L MO. Lane 4, Translation of mouse S1pr5 was unaffected by s1pr5.L MO. Mm: Mus musculus; Xl: Xenopus laevis.
	Supplementary Fig. 7. Expression profile of the sp1r5.S receptor gene, in vivo test of MO specificity and phenotypes caused by its knock-down (related to Fig. 6). (A) The s1pr5.S receptor displays a restricted expression profile in the adult frog and is expressed in the mesonephric tissue. Adult tissues were dissected and total RNAs from adult tissues were extracted using Trizol (Invitrogen) following the manufacturer’s protocol. RT- PCR was performed along with negative control. (B) The novel s1pr5.S receptor is expressed in the kidney with an expression profile similar to its homelog, the s1pr5.L receptor. X.laevis embryos were dissected and total RNA extracted. RT-PCR was performed on dissected tissues and control whole embryos along with negative control. S1pr5.S was amplified using the following primers (forward primer, 5’- ggaggtctcgttgctgtctc -3’ and the reverse primer, 5’- cggtagctcctcgtgtaacc -3’) with the annealing temperature of 53°C and 32 cycles, Each RT-PCR product was sequenced to confirm the specificity of the amplifications. (C) Alignment of the 5’UTR of X.laevis s1pr5 homeologs sequences and position of s1pr5.L and s1pr5.S MOs. The ATG is indicated in red and identical nucleotides by dots. Only 4 nucleotides over the whole MOs sequences differ between the two genes. (D) Efficacy of the s1pr5.L and s1pr5.L MOs. Schematic representation of the GFP fusion proteins containing the 5’UTR and part of the coding region of s1pr5.L and s1pr5.S. The position of the s1pr5.L and s1pr5.s MO are indicated. Xenopus embryos were injected with the s1pr5.LGFP, s1pr5.S -GFP and GFP mRNAs at one cell stage followed by unilateral injections of s1pr5.L, s1pr5.S and control MOs in presence of LacZ mRNA at 2-cell stage. GFP+ positive embryos were sorted at stage 16 and stained for ß-galactosidase activity. The numbers of embryos GFP+ fluorescent on one side and LacZ+ on the opposite side and the percentage of efficiency of the different MOs to inhibit in vivo the translation of the different mRNAs are indicated in the table. (E) Microinjection of s1pr5.S MO induces a similar kidney phenotype than the microinjection of the s1pr5.L MO. Injected embryos analysed by 3G8/4A6 antibody staining at stage 41. (a) Embryo injected with 15ng of s1pr5.S MO (b) Embryo injected with 15ng of s1pr5.L MO. (c) Embryo injected with 15ng of control MO. Asterisk denotes uninjected sides. The raw data and statistical analyses are provided in Supplementary Table 5.
	Supplementary Fig. 8. Enpp4 does not interact with bioactive lipids metabolized by enpp2, enpp6 and enpp7 (related to Fig. 7). ShingoStripsTM was incubated with membrane protein extracts from (A) control pcDNA3.1 transfected CHO cells or (B) from enpp4 over-expressing CHO cells and the bound enpp4 protein detected with anti-Xlenpp4 serum. LP A, lysophosphatidic acid; LPC, lysophosphocholine; PC, phospatidylcholine; S1P , shingosine-1-phosphate; SPC, Shingosylphosphorylcholine.

Alarcón, A dual requirement for Iroquois genes during Xenopus kidney development. 2008, Pubmed, Xenbase

Alarcón, A dual requirement for Iroquois genes during Xenopus kidney development. 2008, Pubmed , Xenbase
Albright, NPP4 is a procoagulant enzyme on the surface of vascular endothelium. 2012, Pubmed
Albright, Molecular basis of purinergic signal metabolism by ectonucleotide pyrophosphatase/phosphodiesterases 4 and 1 and implications in stroke. 2014, Pubmed
Arima, Global analysis of RAR-responsive genes in the Xenopus neurula using cDNA microarrays. 2005, Pubmed , Xenbase
Belfiore, Overexpression of membrane glycoprotein PC-1 in MDA-MB231 breast cancer cells is associated with inhibition of insulin receptor tyrosine kinase activity. 1996, Pubmed
Bell, Mechanism of regulation of protein kinase C by lipid second messengers. 1986, Pubmed
Brennan, The specification of the pronephric tubules and duct in Xenopus laevis. 1998, Pubmed , Xenbase
Buisson, Pax8 and Pax2 are specifically required at different steps of Xenopus pronephros development. 2015, Pubmed , Xenbase
Burnstock, Purinergic signalling in the kidney in health and disease. 2014, Pubmed
Burnstock, Purine and purinergic receptors. 2018, Pubmed
Carroll, Synergism between Pax-8 and lim-1 in embryonic kidney development. 1999, Pubmed , Xenbase
Cartry, Retinoic acid signalling is required for specification of pronephric cell fate. 2006, Pubmed , Xenbase
Chan, A role for Xlim-1 in pronephros development in Xenopus laevis. 2000, Pubmed , Xenbase
Cirio, Lhx1 is required for specification of the renal progenitor cell field. 2011, Pubmed , Xenbase
Cohen, Perspectives on RUNX genes: an update. 2009, Pubmed
Dennis, Phosphodiesterase-Ialpha/autotaxin (PD-Ialpha/ATX): a multifunctional protein involved in central nervous system development and disease. 2005, Pubmed
Desgrange, Nephron Patterning: Lessons from Xenopus, Zebrafish, and Mouse Studies. 2015, Pubmed , Xenbase
Drews, The nephrogenic potential of the transcription factors osr1, osr2, hnf1b, lhx1 and pax8 assessed in Xenopus animal caps. 2011, Pubmed , Xenbase
Dwyer, Conversion of extracellular ATP into adenosine: a master switch in renal health and disease. 2020, Pubmed
Futel, TRPP2-dependent Ca2+ signaling in dorso-lateral mesoderm is required for kidney field establishment in Xenopus. 2015, Pubmed , Xenbase
Glusman, An enigmatic fourth runt domain gene in the fugu genome: ancestral gene loss versus accelerated evolution. 2004, Pubmed
Grupe, Inhibition of insulin receptor phosphorylation by PC-1 is not mediated by the hydrolysis of adenosine triphosphate or the generation of adenosine. 1995, Pubmed
Haines, Glycosylation regulates Notch signalling. 2003, Pubmed
Haldin, The lmx1b gene is pivotal in glomus development in Xenopus laevis. 2008, Pubmed , Xenbase
Harland, In situ hybridization: an improved whole-mount method for Xenopus embryos. 1991, Pubmed , Xenbase
Huwiler, Sphingolipid signaling in renal fibrosis. 2018, Pubmed
Im, Characterization of a novel sphingosine 1-phosphate receptor, Edg-8. 2000, Pubmed , Xenbase
Jo, Sphingosine-1-phosphate receptors: biology and therapeutic potential in kidney disease. 2008, Pubmed
Jones, Xenopus: a prince among models for pronephric kidney development. 2005, Pubmed , Xenbase
Kihara, Lysophospholipid receptor nomenclature review: IUPHAR Review 8. 2014, Pubmed
Kirby, Dynamic regulation of sphingosine-1-phosphate homeostasis during development of mouse metanephric kidney. 2009, Pubmed
Krneta-Stankic, Xenopus: leaping forward in kidney organogenesis. 2017, Pubmed , Xenbase
Kyuno, A functional screen for genes involved in Xenopus pronephros development. 2008, Pubmed , Xenbase
Le Bouffant, Retinoic acid-dependent control of MAP kinase phosphatase-3 is necessary for early kidney development in Xenopus. 2012, Pubmed , Xenbase
Leclerc, An increase in intracellular Ca2+ is involved in pronephric tubule differentiation in the amphibian Xenopus laevis. 2008, Pubmed , Xenbase
Leventis, The distribution and function of phosphatidylserine in cellular membranes. 2010, Pubmed
Lienkamp, Using Xenopus to study genetic kidney diseases. 2016, Pubmed , Xenbase
Lyons, Requirement of Wnt/beta-catenin signaling in pronephric kidney development. 2009, Pubmed , Xenbase
Mas, Gene expression patterns in deceased donor kidneys developing delayed graft function after kidney transplantation. 2008, Pubmed
Massé, Ectophosphodiesterase/nucleotide phosphohydrolase (Enpp) nucleotidases: cloning, conservation and developmental restriction. 2010, Pubmed , Xenbase
Massé, The lysophosphatidic acid (LPA) and sphingosine-1-phosphate (S1P) receptor gene families: cloning and comparative expression analysis in Xenopus laevis. 2010, Pubmed , Xenbase
McLaughlin, Notch regulates cell fate in the developing pronephros. 2000, Pubmed , Xenbase
Möller, Monitoring the expression of purinoceptors and nucleotide-metabolizing ecto-enzymes with antibodies directed against proteins in native conformation. 2007, Pubmed
Naylor, BMP and retinoic acid regulate anterior-posterior patterning of the non-axial mesoderm across the dorsal-ventral axis. 2016, Pubmed
Naylor, Notch activates Wnt-4 signalling to control medio-lateral patterning of the pronephros. 2009, Pubmed , Xenbase
Ohe, Characterization of nucleotide pyrophosphatase-5 as an oligomannosidic glycoprotein in rat brain. 2003, Pubmed
Park, Role of lysophosphatidic acid and its receptors in the kidney. 2017, Pubmed
Raciti, Organization of the pronephric kidney revealed by large-scale gene expression mapping. 2008, Pubmed , Xenbase
Reggiani, The prepattern transcription factor Irx3 directs nephron segment identity. 2007, Pubmed , Xenbase
Sakagami, Biochemical and molecular characterization of a novel choline-specific glycerophosphodiester phosphodiesterase belonging to the nucleotide pyrophosphatase/phosphodiesterase family. 2005, Pubmed
Sanchez, Structural and functional characteristics of S1P receptors. 2004, Pubmed
Saulnier, Essential function of Wnt-4 for tubulogenesis in the Xenopus pronephric kidney. 2002, Pubmed , Xenbase
Seville, Annexin IV (Xanx-4) has a functional role in the formation of pronephric tubules. 2002, Pubmed , Xenbase
Solini, The dark side of extracellular ATP in kidney diseases. 2015, Pubmed
Stefan, NPP-type ectophosphodiesterases: unity in diversity. 2005, Pubmed
Suresh, A family with cleidocranial dysplasia and crossed ectopic kidney in one child. 2009, Pubmed
Taelman, The Notch-effector HRT1 gene plays a role in glomerular development and patterning of the Xenopus pronephros anlagen. 2006, Pubmed , Xenbase
Van Campenhout, Evi1 is specifically expressed in the distal tubule and duct of the Xenopus pronephros and plays a role in its formation. 2006, Pubmed , Xenbase
van den Eijnde, Transient expression of phosphatidylserine at cell-cell contact areas is required for myotube formation. 2001, Pubmed
Vize, Development of the Xenopus pronephric system. 1995, Pubmed , Xenbase
Wessely, Xenopus pronephros development--past, present, and future. 2011, Pubmed , Xenbase
Wingert, The cdx genes and retinoic acid control the positioning and segmentation of the zebrafish pronephros. 2007, Pubmed , Xenbase
Yan, Homology modeling and docking studies of ENPP4: a BCG activated tumoricidal macrophage protein. 2016, Pubmed
Zimmermann, Cellular function and molecular structure of ecto-nucleotidases. 2012, Pubmed